![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR171c |
|||||
Accession | MI0001134 (change log) | ||||
Description | Oryza sativa miR171c stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
43 open access papers mention osa-MIR171c | ||||
Stem-loop |
gu ga g ug a cuu u gaa 5' gg acg gauauugg cgguucaaucaga ag g gcucc g || ||| |||||||| ||||||||||||| || | ||||| 3' cc ugc cuauaacc gccgaguuaguuu uc c cgggg g uu gc a gu c -ac u agc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR171c-5p |
|
Accession | MIMAT0022877 |
Sequence |
10 - ggauauuggugcgguucaauc - 30 |
Deep sequencing | 109 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR171c-3p |
|
Accession | MIMAT0001064 |
Previous IDs | osa-miR171c |
Sequence |
69 - ugauugagccgugccaauauc - 89 |
Deep sequencing | 545 reads, 2 experiments |
Evidence | by similarity; MI0000214 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|