Stem-loop sequence osa-MIR171c

Accession

MI0001134 (change log)

Description

Oryza sativa miR171c stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

43 open access papers mention osa-MIR171c
(242 sentences)

Stem-loop

   gu  ga   g        ug             a  cuu u     gaa 
5'   gg  acg gauauugg  cgguucaaucaga ag   g gcucc   g
     ||  ||| ||||||||  ||||||||||||| ||   | |||||    
3'   cc  ugc cuauaacc  gccgaguuaguuu uc   c cgggg   g
   uu  gc   a        gu             c  -ac u     agc 

Deep sequencing

654 reads, 300 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context

• Coordinates (MSU7): Chr4: 31713472-31713570 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001134

Mature sequence osa-miR171c-5p

• Accession: MIMAT0022877
• Sequence: 10 - ggauauuggugcgguucaauc - 30
• Deep sequencing: 109 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS0000563BFF_39947

Mature sequence osa-miR171c-3p

• Accession: MIMAT0001064
• Previous IDs: osa-miR171c
• Sequence: 69 - ugauugagccgugccaauauc - 89
• Deep sequencing: 545 reads, 2 experiments
• Evidence: by similarity; MI0000214
• Database links:
  • RNAcentral:URS000054D5EF_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).