Stem-loop sequence osa-MIR171d

Accession

MI0001135 (change log)

Description

Oryza sativa miR171d stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

44 open access papers mention osa-MIR171d
(145 sentences)

Stem-loop

   uugua   au         c       c     ----------    u   c g    -ga   g     ga 
5'      gcu  gauguuggc cggcuca ucaga          ugga cau g ugca   aga ugcau  a
        |||  ||||||||| ||||||| |||||          |||| ||| | ||||   ||| |||||  u
3'      cga  cuauaaccg gccgagu agucu          accu gua u augu   ucu acgua  c
   uacca   cu         u       u     ucaaggucgu    c   - g    gac   g     gu 

Deep sequencing

594 reads, 300 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context

• Coordinates (MSU7): Chr10: 21237313-21237447 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001135

Mature sequence osa-miR171d-5p

• Accession: MIMAT0022878
• Sequence: 13 - uguuggcccggcucacucaga - 33
• Deep sequencing: 45 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS000036264E_39947

Mature sequence osa-miR171d-3p

• Accession: MIMAT0001065
• Previous IDs: osa-miR171d
• Sequence: 105 - ugauugagccgugccaauauc - 125
• Deep sequencing: 548 reads, 2 experiments
• Evidence: by similarity; MI0000214
• Database links:
  • RNAcentral:URS000054D5EF_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).