Stem-loop sequence osa-MIR171e

Accession

MI0001136 (change log)

Description

Oryza sativa miR171e stem-loop

Gene family

MIPF0000030; MIR171_1

Literature search

42 open access papers mention osa-MIR171e
(153 sentences)

Stem-loop

   -u    g   u         u       c     c     uggc    u  ---a       c 
5'   ggua cua gauguuggc cggcuca ucaga ggcau    guga gc    aagcaug a
     |||| ||| ||||||||| ||||||| ||||| |||||    |||| ||    |||||||  
3'   ucgu gau cuauaaccg gccgagu agucu uugug    cacu cg    uucgugc u
   uc    -   u         u       u     -     --uu    -  aucg       g 

Deep sequencing

589 reads, 300 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors.

Genome context

• Coordinates (MSU7): Chr3: 1970487-1970605 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001136

Mature sequence osa-miR171e-5p

• Accession: MIMAT0022879
• Sequence: 13 - uguuggcucggcucacucaga - 33
• Deep sequencing: 49 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS000018872A_39947

Mature sequence osa-miR171e-3p

• Accession: MIMAT0001066
• Previous IDs: osa-miR171e
• Sequence: 89 - ugauugagccgugccaauauc - 109
• Deep sequencing: 539 reads, 2 experiments
• Evidence: by similarity; MI0000214
• Database links:
  • RNAcentral:URS000054D5EF_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).