![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR171e |
|||||
Accession | MI0001136 (change log) | ||||
Description | Oryza sativa miR171e stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
42 open access papers mention osa-MIR171e | ||||
Stem-loop |
-u g u u c c uggc u ---a c 5' ggua cua gauguuggc cggcuca ucaga ggcau guga gc aagcaug a |||| ||| ||||||||| ||||||| ||||| ||||| |||| || ||||||| 3' ucgu gau cuauaaccg gccgagu agucu uugug cacu cg uucgugc u uc - u u u - --uu - aucg g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR171 family [1]. It is predicted to target mRNAs coding for SCARECROW-like transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR171e-5p |
|
Accession | MIMAT0022879 |
Sequence |
13 - uguuggcucggcucacucaga - 33 |
Deep sequencing | 49 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR171e-3p |
|
Accession | MIMAT0001066 |
Previous IDs | osa-miR171e |
Sequence |
89 - ugauugagccgugccaauauc - 109 |
Deep sequencing | 539 reads, 2 experiments |
Evidence | by similarity; MI0000214 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|