Stem-loop sequence osa-MIR166g

Accession

MI0001142 (change log)

Description

Oryza sativa miR166g stem-loop

Gene family

MIPF0000004; MIR166

Literature search

70 open access papers mention osa-MIR166g
(263 sentences)

Stem-loop

             cu         g   a   a     auugcuuggugcaaaauacuagggcauuguuguaag 
5' agcauggugu  ggaauggag cug ucc agauc                                    u
   ||||||||||  ||||||||| ||| ||| |||||                                    g
3' ucgugccaca  ccuuacuuc gac agg ucuag                                    c
             cu         g   c   c     gagcuauuguuugagccuuuguuuuuucuugauuac 

Deep sequencing

36881 reads, 2.43e+04 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context

• Coordinates (MSU7): Chr12: 18329367-18329511 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001142

Mature sequence osa-miR166g-5p

• Accession: MIMAT0022881
• Sequence: 15 - aauggaggcugauccaagauc - 35
• Deep sequencing: 3 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS0000556916_39947

Mature sequence osa-miR166g-3p

• Accession: MIMAT0001072
• Previous IDs: osa-miR166g
• Sequence: 115 - ucggaccaggcuucauuccuc - 135
• Deep sequencing: 36878 reads, 2 experiments
• Evidence: by similarity; MI0000201
• Database links:
  • RNAcentral:URS0000127C0D_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).