Stem-loop sequence osa-MIR166h

Accession MI0001143
Description Oryza sativa miR166h stem-loop
Gene family MIPF0000004; MIR166
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gg                uu g    cu   g  a       cuuaau   ucu     ga 
  uggcuuguggggaaug  g cugg  cga gu uccacau      ucc   ccggc  u
  ||||||||||||||||  | ||||  ||| || |||||||      |||   |||||   
  gccgaacgcuccuuac  c gacc  gcu cg aggugug      ggg   ggccg  c
ua                uu g    ag   g  a       -----c   cuc     ag 
Get sequence
Deep sequencing
12086 reads, 4 experiments
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 32435174-32435292 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR166h
osa-MIR166h Chr2: 32435174-32435292 [-]
osa-MIR166k Chr2: 32435003-32435129 [-]

Mature sequence osa-miR166h-5p

Accession MIMAT0022882
Sequence

13 - 

ggaauguuggcuggcucgagg

 - 33

Get sequence
Deep sequencing 552 reads, 3 experiments
Evidence experimental; Solexa [2]

Mature sequence osa-miR166h-3p

Accession MIMAT0001073
Previous IDs osa-miR166h
Sequence

89 - 

ucggaccaggcuucauuccuc

 - 109

Get sequence
Deep sequencing 11534 reads, 4 experiments
Evidence by similarity; MI0000201

References

1
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).