Stem-loop sequence osa-MIR166i

Accession

MI0001144 (change log)

Description

Oryza sativa miR166i stem-loop

Gene family

MIPF0000004; MIR166

Literature search

70 open access papers mention osa-MIR166i
(263 sentences)

Stem-loop

   agaua     uu      c          a            -------      -g  -      --a       u 
5'      ggugu  ggaaug aguuugaucc agaucugccuau       auauau  gu guguau   ucauauc u
        |||||  |||||| |||||||||| ||||||||||||       ||||||  || ||||||   |||||||  
3'      ccaca  ccuuac ucggacuagg ucuagauggaug       ugugug  ca cguaua   gguauag g
   cauaa     cu      u          c            gggacag      ga  a      ggg       u 

Deep sequencing

29803 reads, 2.03e+04 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context

• Coordinates (MSU7): Chr3: 25294953-25295097 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001144

Mature sequence osa-miR166i-5p

• Accession: MIMAT0022883
• Sequence: 15 - aaugcaguuugauccaagauc - 35
• Evidence: experimental; Illumina [2]

Mature sequence osa-miR166i-3p

• Accession: MIMAT0001074
• Previous IDs: osa-miR166i
• Sequence: 115 - ucggaucaggcuucauuccuc - 135
• Deep sequencing: 29799 reads, 2 experiments
• Evidence: by similarity; MI0000201
• Database links:
  • RNAcentral:URS00002AFDE4_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).