![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR166i |
|||||
Accession | MI0001144 (change log) | ||||
Description | Oryza sativa miR166i stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
70 open access papers mention osa-MIR166i | ||||
Stem-loop |
agaua uu c a ------- -g - --a u 5' ggugu ggaaug aguuugaucc agaucugccuau auauau gu guguau ucauauc u ||||| |||||| |||||||||| |||||||||||| |||||| || |||||| ||||||| 3' ccaca ccuuac ucggacuagg ucuagauggaug ugugug ca cguaua gguauag g cauaa cu u c gggacag ga a ggg u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR166i-5p |
|
Accession | MIMAT0022883 |
Sequence |
15 - aaugcaguuugauccaagauc - 35 |
Evidence | experimental; Illumina [2] |
Mature sequence osa-miR166i-3p |
|
Accession | MIMAT0001074 |
Previous IDs | osa-miR166i |
Sequence |
115 - ucggaucaggcuucauuccuc - 135 |
Deep sequencing | 29799 reads, 2 experiments |
Evidence | by similarity; MI0000201 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|