Stem-loop sequence gga-let-7i

AccessionMI0001168 (change log)
DescriptionGallus gallus let-7i stem-loop
Gene family MIPF0000002; let-7
Literature search

49 open access papers mention gga-let-7i
(229 sentences)

Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
432959 reads, 5.36e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 33060797-33060880 [+]
sense
ENSGALT00000028944 ; gga-let-7i-201; exon 1
Database links

Mature sequence gga-let-7i

Accession MIMAT0001098
Sequence

6 - 

ugagguaguaguuugugcugu

 - 26

Get sequence
Deep sequencing432397 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).