Stem-loop sequence gga-mir-221

Accession MI0001178
Description Gallus gallus miR-221 stem-loop
Gene family MIPF0000051; mir-221
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-221 microRNA (and it's paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gacug       uugg  cau     ug   u         auuu    -   u 
     uccaggu    gg   gaacc  gca acaauguag    cugu guu g
     |||||||    ||   |||||  ||| |||||||||    |||| ||| u
     agguccg    cc   uuugg  cgu uguuacauc    gaca cga u
----a       ucga  ---     gu   c         ----    a   a 
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr1: 109977681-109977779 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-221
gga-mir-222a chr1: 109977177-109977274 [+]
gga-mir-221 chr1: 109977681-109977779 [+]
Database links

Mature sequence gga-miR-221

Accession MIMAT0001108
Sequence

64 - 

agcuacauugucugcuggguuuc

 - 86

Get sequence
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).