Stem-loop sequence gga-mir-148a

AccessionMI0001189
DescriptionGallus gallus miR-148a stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     ag            --a    ca    -   gu 
5' ga  caaaguucugug   cacu  gacu cug  u
   ||  ||||||||||||   ||||  |||| |||  a
3' cu  guuucaagacau   guga  cuga gau  c
     cu            cac    --    c   ag 
Get sequence
Deep sequencing
473292768 reads, 2.64e+04 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr2: 32253587-32253654 [-]
intergenic
Database links

Mature sequence gga-miR-148a-5p

Accession MIMAT0026503
Sequence

6 - 

aaaguucugugacacucagacu

 - 27

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence gga-miR-148a-3p

Accession MIMAT0001120
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing23349154 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).