Stem-loop sequence gga-mir-18b

Accession MI0001209
Description Gallus gallus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cgugguc         --   u    c   u     ua  --g     
       cuuguguua  agg gcau uag gcagu  gu   acgu 
       |||||||||  ||| |||| ||| |||||  ||   ||| a
       gaacacggu  ucc cgua auc cguca  ua   ugcg 
-------         cu   u    a   c     uc  aga     
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr4: 3946499-3946582 [-]
sense
ENSGALT00000009820 ; F1N8X1_CHICK; intron 2
Clustered miRNAs
< 10kb from gga-mir-18b
gga-mir-106 chr4: 3946630-3946710 [-]
gga-mir-18b chr4: 3946499-3946582 [-]
gga-mir-20b chr4: 3946318-3946402 [-]
Database links

Mature sequence gga-miR-18b

Accession MIMAT0001141
Sequence

15 - 

uaaggugcaucuagugcaguua

 - 36

Get sequence
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).