Gga-mir-137 is a microRNA that has been studied in relation to various biological processes in chickens. It has been implicated in the differential resistance to Marek's disease (MD) in chicken lines, with varying responses observed between the lines [PMC4404578]. In MDV-infected line L72 birds, increased levels of H3K27me3 were found on gga-mir-137 at 5 dpi, while line L63 displayed higher levels regardless of infection status [PMC4404578]. Gga-mir-137 is one of the miRNAs that exhibited putative epigenetic silencing in the resistant line [PMC4404578]. It has also been found to have accessible targets on transcript-based global folding structures [PMC4069037]. In chicken ovary, the expression of gga-mir-137 decreased significantly from 42-d to 162-d [PMC3700833]. Furthermore, gga-mir-137 was found to have higher expression levels in small yellow follicles (6–8 mm) compared to other follicles [PMC3700833]. The functionality of gga-mir-137 and other differentially expressed miRNAs was further examined in ovary tissues and follicles from White Leghorn hens at different stages of development [PMC3700833]. Real-time quantitative RT-PCR was used to validate the expression levels of gga-mir-137 and other selected miRNAs identified through Illumina small RNA deep sequencing [PMC3700833]. Overall, these studies highlight the potential role of gga-mir-137 in MD resistance and follicle development in chickens.
---u -- ug G G - g cug acucucuucgg ACG GUAUUCUUGGGUG AUAAUA cg a ||| ||||||||||| ||| ||||||||||||| |||||| || u ggc ugagaggagcu UGC CAUAAGAAUUCGU UAUugu gc u cggc ca GA G - u a
Accession | MIMAT0001153 |
Description | Gallus gallus gga-miR-137-3p mature miRNA |
Sequence | 55 - UAUUGCUUAAGAAUACGCGUAG - 76 |
Evidence |
experimental
Illumina [2] |
Database links | |
Predicted targets |
Accession | MIMAT0026523 |
Description | Gallus gallus gga-miR-137-5p mature miRNA |
Sequence | 18 - ACGGGUAUUCUUGGGUGGAUAAUA - 41 |
Evidence |
experimental
Illumina [2] |
|