Stem-loop sequence gga-let-7g

AccessionMI0001230 (change log)
DescriptionGallus gallus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

46 open access papers mention gga-let-7g
(224 sentences)

Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   -   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
9063270 reads, 1.12e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 2971911-2971993 [-]
sense
ENSGALT00000028969 ; gga-let-7g-201; exon 1
ENSGALT00000036280 ; WDR82-201; intron 2
Database links

Mature sequence gga-let-7g-5p

Accession MIMAT0001160
Sequence

5 - 

ugagguaguaguuuguacagu

 - 25

Get sequence
Deep sequencing9063009 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-let-7g-3p

Accession MIMAT0026527
Sequence

62 - 

cuguacaggccacugccuugcc

 - 83

Get sequence
Deep sequencing256 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).