Stem-loop sequence gga-mir-130a

Accession

MI0001241 (change log)

Description

Gallus gallus miR-130a stem-loop

Gene family

MIPF0000034; mir-130

Literature search

10 open access papers mention gga-mir-130a
(15 sentences)

Stem-loop

   ug      u    a        uc         a  g -  a 
5'   cuguug ccag gcccuuuu  uguuguacu cu g ca u
     |||||| |||| ||||||||  ||||||||| || | ||  
3'   gacggu gguu cgggaaaa  auaacguga ga u gu u
   --      c    a        uu         c  g a  a 

Deep sequencing

52164 reads, 580 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr15: 407968-408050 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from gga-mir-130a

• gga-mir-130a: chr15: 407968-408050 [-]
• gga-mir-301a: chr15: 406743-406835 [-]
• gga-mir-454: chr15: 400264-400384 [-]
• gga-mir-130b: chr15: 399151-399227 [-]

Database links

• EntrezGene:
• RNAcentral:URS000075F032_9031
• miRBase Tracker:MI0001241

Mature sequence gga-miR-130a-5p

• Accession: MIMAT0026532
• Sequence: 15 - gcccuuuuucuguuguacuacu - 36
• Deep sequencing: 218 reads, 5 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-130a-5p
  • miRDB:gga-miR-130a-5p

Mature sequence gga-miR-130a-3p

• Accession: MIMAT0001167
• Sequence: 52 - cagugcaauauuaaaagggcau - 73
• Deep sequencing: 51946 reads, 5 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS00004D1582_9031
• Predicted targets:
  • TargetScanVert:gga-miR-130a-3p
  • miRDB:gga-miR-130a-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).