Stem-loop sequence gga-mir-133c

Accession MI0001255
Previous IDs gga-mir-133a-3
Description Gallus gallus miR-133c stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u    uc   g       aaa    -a        aacu 
 gccu  cug ggcuggu   aagg  accagauc    a
 ||||  ||| |||||||   ||||  ||||||||    c
 cggg  gac ucgacca   uucc  ugguuuag    a
a    gu   g       -ac    cc        guca 
Get sequence
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr23: 4294451-4294529 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-133c
gga-mir-1b chr23: 4294312-4294375 [+]
gga-mir-133c chr23: 4294451-4294529 [+]
Database links

Mature sequence gga-miR-133c

Accession MIMAT0001176
Sequence

49 - 

uugguccccuucaaccagcugc

 - 70

Get sequence
Evidence by similarity; MI0000451
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).