Stem-loop sequence gga-let-7k

AccessionMI0001263 (change log)
DescriptionGallus gallus let-7k stem-loop
Gene family MIPF0000002; let-7
Literature search

45 open access papers mention gga-let-7k
(225 sentences)

Stem-loop
   --------  cu   gu         a      -  ------    uc 
5'         gg  gag  aguagauug auaguu gu      ggag  c
           ||  |||  ||||||||| |||||| ||      ||||  u
3'         cc  uuc  ucaucuaac uaucaa cg      ccuc  a
   agaggaau  -u   ug         a      u  aguuuc    cu 
Get sequence
Deep sequencing
7106836 reads, 8.38e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 1640128-1640210 [-]
intergenic
Clustered miRNAs
< 10kb from gga-let-7k
gga-let-7kchr26: 1640128-1640210 [-]
gga-let-7jchr26: 1639928-1640010 [-]
Database links

Mature sequence gga-let-7k-5p

Accession MIMAT0001182
Sequence

4 - 

ugagguaguagauugaauaguu

 - 25

Get sequence
Deep sequencing7105968 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence gga-let-7k-3p

Accession MIMAT0026543
Sequence

54 - 

cuauacaaucuacugucuuucc

 - 75

Get sequence
Deep sequencing865 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).