Stem-loop sequence gga-mir-142

AccessionMI0001281 (change log)
DescriptionGallus gallus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Literature search

8 open access papers mention gga-mir-142
(35 sentences)

Stem-loop
   g        g   c           a         u aa a    
5'  acagugca uca ccauaaaguag aagcacuac a  c gca 
    |||||||| ||| ||||||||||| ||||||||| |  | || c
3'  ugucaugu agu gguauuucauc uuugugaug u  g cgu 
   g        g   a           c         - gg a    
Get sequence
Deep sequencing
111199 reads, 1.18e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 510413-510500 [-]
intergenic
Database links

Mature sequence gga-miR-142-5p

Accession MIMAT0001193
Sequence

14 - 

cccauaaaguagaaagcacuac

 - 35

Get sequence
Deep sequencing9513 reads, 5 experiments
Evidence experimental; cloned [2-3], Northern [2]
Database links
Predicted targets

Mature sequence gga-miR-142-3p

Accession MIMAT0001194
Sequence

53 - 

uguaguguuuccuacuuuaugg

 - 74

Get sequence
Deep sequencing101677 reads, 5 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
" McBride D, Carre W, Law A, Clinton M Unpublished.
5
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).