Stem-loop sequence dre-mir-10b-1

AccessionMI0001364
Previous IDsdre-mir-10b
DescriptionDanio rerio miR-10b-1 stem-loop
Gene family MIPF0000033; mir-10
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-10_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-10 microRNA precursor is a short non-coding RNA gene involved in gene regulation. It is part of an RNA gene family which contains miR-10, miR-51, miR-57, miR-99 and miR-100. miR-10, miR-99 and miR-100 have now been predicted or experimentally confirmed in a wide range of species. (MIPF0000033, MIPF0000025) mir-51 and mir-57 have currently only been identified in the nematode Caenorhabditis elegans (MIPF0000268, MIPF0000271). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gu        a    g     c          ugaaaa 
5'   cuauauau cccu uagaa cgaauuugug      a
     |||||||| |||| ||||| ||||||||||      a
3'   gguauaug gggg aucuu gcuuagacac      u
   cu        a    -     a          uuacaa 
Get sequence
Deep sequencing
7179 reads, 732 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The miR-10b sequence described in [1] is offset by 2 nt with respect to that cloned in mouse (MI0000221).

Genome context
Coordinates (Zv9) Overlapping transcripts
9: 1943755-1943832 [-]
sense
OTTDART00000047316 ; hoxd3a-002; intron 1
OTTDART00000047317 ; si:rp71-78h1.11-001; exon 2
ENSDART00000138730 ; hoxd3a-002; intron 1
ENSDART00000140438 ; si:rp71-78h1.11-001; exon 2
Database links

Mature sequence dre-miR-10b-5p

Accession MIMAT0001268
Previous IDsdre-miR-10b
Sequence

10 - 

uacccuguagaaccgaauuugug

 - 32

Get sequence
Deep sequencing29162 reads, 4 experiments
Evidence experimental; cloned [1]
Validated targets

Mature sequence dre-miR-10b-3p

Accession MIMAT0031919
Sequence

49 - 

acagauucgauucuaggggagu

 - 70

Get sequence
Deep sequencing1601 reads, 4 experiments
Evidence not experimental

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).
3
PMID:16736008 "The zebrafish hoxDb cluster has been reduced to a single microRNA" Woltering JM, Durston AJ Nat Genet. 38:601-602(2006).