Stem-loop sequence dre-mir-217

AccessionMI0001383
Previous IDsdre-mir-217;dre-mir-217-1
DescriptionDanio rerio miR-217 stem-loop
Gene family MIPF0000077; mir-217
Stem-loop
   augagaa     u          auac                u  ---a  a 
5'        cuuuc gauguuggug    ugcaucaggaacugau gg    ug u
          ||||| ||||||||||    |||||||||||||||| ||    || a
3'        gaaag cuacgacuac    acguaguccuugacua cc    ac u
   ------a     -          ccuc                -  gagg  u 
Get sequence
Deep sequencing
5049 reads, 483 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
22: 31336479-31336576 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-217
dre-mir-216b22: 31337021-31337097 [-]
dre-mir-216a22: 31336713-31336801 [-]
dre-mir-21722: 31336479-31336576 [-]
Database links

Mature sequence dre-miR-217

Accession MIMAT0001285
Sequence

25 - 

uacugcaucaggaacugauugg

 - 46

Get sequence
Deep sequencing4691 reads, 4 experiments
Evidence experimental; cloned [1-2]

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).