Stem-loop sequence cbr-mir-360

AccessionMI0001405 (change log)
DescriptionCaenorhabditis briggsae miR-360 stem-loop
Gene family MIPF0000210; mir-360
Stem-loop
   --uuc   -aaaa    -  c      u      c  uu          ---au   u 
5'      cau     aagc gc uagggu uuguga cg  guuacgguca     uca g
        |||     |||| || |||||| |||||| ||  ||||||||||     |||  
3'      gua     uucg ug guucca aacacu gc  uaaugccagu     agu u
   uuaaa   auaag    g  u      c      u  cc          aacac   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA is the predicted homologue of a verified C. elegans miRNA [1]. Its expression has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 11259453-11259563 [+]
intergenic
Database links

Mature sequence cbr-miR-360

Accession MIMAT0001303
Sequence

63 - 

ugaccguaaucccguucacaa

 - 83

Get sequence
Evidence by similarity; MI0000759

References

1