Stem-loop sequence sbi-MIR166b

AccessionMI0001499 (change log)
DescriptionSorghum bicolor miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention sbi-MIR166b
(13 sentences)

Stem-loop
            u   c         a    gu  g  g 
5' ggggaauga guc gguccgaag cgcu  gc gc a
   ||||||||| ||| ||||||||| ||||  || ||  
3' ccccuuacu cgg ccaggcuuc gcgg  cg cg a
            u   a         g    --  g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 7384211-7384282 [+]
intergenic
Database links

Mature sequence sbi-miR166b

Accession MIMAT0001393
Sequence

52 - 

ucggaccaggcuucauuccc

 - 71

Get sequence
Evidence by similarity; MI0000201

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).