Stem-loop sequence mtr-MIR169a

AccessionMI0001741 (change log)
DescriptionMedicago truncatula miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

12 open access papers mention mtr-MIR169a
(52 sentences)

Stem-loop
   a     ca      g    gc         ug        aca   --uu   -   ugu  a 
5'  agagg  gagaga uaau  agccaagga  acuugccg   aca    ggc gaa   uc u
    |||||  |||||| ||||  |||||||||  ||||||||   |||    ||| |||   ||  
3'  ucuuc  cucucu auug  ucgguuccu  ugaacggc   ugu    ccg cuu   ag g
   -     ua      g    ua         gu        -cg   uacu   u   --u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
contig_79842: 860-980 [+]
intergenic
Database links

Mature sequence mtr-miR169a

Accession MIMAT0001643
Sequence

21 - 

cagccaaggaugacuugccga

 - 41

Get sequence
Evidence not experimental

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).