![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR166a |
|||||
Accession | MI0001775 (change log) | ||||
Description | Glycine max miR166a stem-loop | ||||
Gene family | MIPF0000004; MIR166 | ||||
Literature search |
![]()
39 open access papers mention gma-MIR166a | ||||
Stem-loop |
-ac uu cuu a uu cu g c -ucuuca --uu a 5' ggaagc ugu uug ggggaaug gucugg cga gac cu ucuugauc guguag c |||||| ||| ||| |||||||| |||||| ||| ||| || |||||||| |||||| 3' ccuucg aua aac ccccuuac cggacc gcu uug ga ggaacugg cguauc u aaa -u -uu c uu ag g u uacauaa uguu a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR166a-5p |
|
Accession | MIMAT0020920 |
Sequence |
23 - ggaauguugucuggcucgagg - 43 |
Evidence | experimental; Illumina [3] |
Mature sequence gma-miR166a-3p |
|
Accession | MIMAT0001677 |
Previous IDs | gma-miR166a |
Sequence |
107 - ucggaccaggcuucauucccc - 127 |
Evidence | experimental; 454 [1], Illumina [3] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|