Stem-loop sequence gma-MIR168a

AccessionMI0001779 (change log)
Previous IDsgma-MIR168
DescriptionGlycine max miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

23 open access papers mention gma-MIR168a
(87 sentences)

Stem-loop
   ---    gu        ua     c          u     a       uc    -  --aa  ga 
5'    cacu  gcggucuc  auucg uuggugcagg cggga ccgguuu  gcgc gg    ug  g
      ||||  ||||||||  ||||| |||||||||| ||||| |||||||  |||| ||    ||   
3'    gugg  cgccggag  uaagu aacuacguuc gcccu gguuaag  cgcg cc    gc  g
   caa    --        gc     c          c     a       -c    g  gcug  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 44068673-44068797 [-]
intergenic
Database links

Mature sequence gma-miR168a

Accession MIMAT0001681
Previous IDsgma-miR168
Sequence

19 - 

ucgcuuggugcaggucgggaa

 - 39

Get sequence
Evidence experimental; 454 [2], Northern [2], Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).