Stem-loop sequence gma-MIR319b

AccessionMI0001783 (change log)
DescriptionGlycine max miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

17 open access papers mention gma-MIR319b
(45 sentences)

Stem-loop
   uaaguccuaag   c  --u   a     uu          cu      u   aa     uu      a -  g   ac       uc  aa         aaag ga 
5'            cga gg   aag gagcu  cuucagucca  uauggg gac  uaaga  ucaauu g cu ccg  ucauuca  ca  ugcugagug    c  a
              ||| ||   ||| |||||  ||||||||||  |||||| |||  |||||  |||||| | || |||  |||||||  ||  |||||||||    |  g
3'            guu uc   uuc cucga  gaagucaggu  augucc uug  auucu  aguuaa c ga ggc  aguaagu  gu  acgacucau    g  a
   ---ucuucuaa   u  uuu   c     gg          uc      u   -a     -u      a a  g   gu       ga  aa         ---a aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 1650575-1650782 [-]
intergenic
Database links

Mature sequence gma-miR319b

Accession MIMAT0001685
Sequence

170 - 

uuggacugaagggagcuccc

 - 189

Get sequence
Evidence experimental; 454 [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).