Stem-loop sequence dre-mir-16a

AccessionMI0001894
DescriptionDanio rerio miR-16a stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-16_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-16 microRNA precursor family is a group of related small non-coding RNA genes that regulates gene expression. miR-16, miR-15, mir-195 and miR-457 are related microRNA precursor sequences from the mir-15 gene family. This microRNA family appears to be vertebrate specific and its members have been predicted or experimentally validated in a wide range of vertebrate species (MIPF0000006).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      u   cg  uu           -        u u   aua  c 
5' ccu ccu  cu  agcagcacgua aauauugg g guu   gu a
   ||| |||  ||  ||||||||||| |||||||| | |||   ||  
3' gga gga  ga  ucgucgugugu uuauaacc c caa   cg a
      c   au  cu           a        - -   --c  g 
Get sequence
Deep sequencing
806 reads, 252 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
15: 1539063-1539149 [+]
sense
OTTDART00000025942 ; smc4-001; intron 5
ENSDART00000130413 ; smc4-001; intron 5
ENSDART00000056765 ; smc4-201; intron 5
Clustered miRNAs
< 10kb from dre-mir-16a
dre-mir-15c15: 1538892-1538974 [+]
dre-mir-16a15: 1539063-1539149 [+]
Database links

Mature sequence dre-miR-16a

Accession MIMAT0001774
Sequence

13 - 

uagcagcacguaaauauuggug

 - 34

Get sequence
Deep sequencing491 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).