Stem-loop sequence dre-mir-23b

AccessionMI0001917
DescriptionDanio rerio miR-23b stem-loop
Gene family MIPF0000027; mir-23
Stem-loop
       cu      --          -  c      ---gug  u 
5' gugg  gugugg  guucuuggca ug ugauuu      ac g
   ||||  ||||||  |||||||||| || ||||||      ||  
3' cacc  cacacc  uagggaccgu ac acuaaa      ug u
       au      au          u  -      aaaaaa  a 
Get sequence
Deep sequencing
5961 reads, 2.48e+03 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
10: 15983153-15983233 [+]
antisense
OTTDART00000043259 ; si:dkey-3h23.2-002; exon 3
OTTDART00000043258 ; si:dkey-3h23.2-001; exon 4
ENSDART00000142357 ; si:dkey-3h23.2-002; exon 3
ENSDART00000144692 ; si:dkey-3h23.2-001; exon 4
Clustered miRNAs
< 10kb from dre-mir-23b
dre-mir-23b10: 15983153-15983233 [+]
dre-mir-27d10: 15983301-15983389 [+]
dre-mir-24-110: 15989409-15989488 [+]
Database links

Mature sequence dre-miR-23b

Accession MIMAT0001791
Sequence

51 - 

aucacauugccagggauuacca

 - 72

Get sequence
Deep sequencing4658 reads, 4 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).