Stem-loop sequence dre-mir-153a

AccessionMI0002021 (change log)
DescriptionDanio rerio miR-153a stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
       g      -             gu       -a   a 
5' gguu ccagug ucauuuuugugau  ugcagcu  guu u
   |||| |||||| |||||||||||||  |||||||  ||| a
3' ucaa gguuac agugaaaacacug  acguuga  cga u
       a      u             au       cc   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 40485510-40485590 [+]
sense
OTTDART00000025249 ; ptprn2-001; intron 19
ENSDART00000052222 ; ptprn2-001; intron 19
ENSDART00000099049 ; ptprn2-201; intron 19
KZ115240.1: 286869-286949 [+]
sense
OTTDART00000025249 ; ptprn2-001; intron 19
ENSDART00000052222 ; ptprn2-001; intron 19
ENSDART00000099049 ; ptprn2-201; intron 19
Database links

Mature sequence dre-miR-153a-5p

Accession MIMAT0031978
Sequence

11 - 

gucauuuuugugauguugcagcu

 - 33

Get sequence
Evidence not experimental
Database links

Mature sequence dre-miR-153a-3p

Accession MIMAT0001849
Previous IDsdre-miR-153a
Sequence

50 - 

uugcauagucacaaaagugauc

 - 71

Get sequence
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).