Stem-loop sequence dre-mir-459

AccessionMI0002180
DescriptionDanio rerio miR-459 stem-loop
Gene family MIPF0001322; mir-459
Stem-loop
   cc     cu          ag     au       u   ac 
5'   ucuug  cucaguaaca  gauuc  ccuguug ggu  u
     |||||  ||||||||||  |||||  ||||||| |||   
3'   ggaau  gggucauugu  cuaag  ggacaac cua  c
   uu     ug          cu     --       -   aa 
Get sequence
Deep sequencing
25 reads, 2.74 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Zv9) Overlapping transcripts
1: 1275348-1275428 [+]
intergenic
Database links

Mature sequence dre-miR-459-5p

Accession MIMAT0001886
Previous IDsdre-miR-459
Sequence

11 - 

ucaguaacaaggauucauccug

 - 32

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; cloned [1]

Mature sequence dre-miR-459-3p

Accession MIMAT0003408
Previous IDsdre-miR-459*
Sequence

52 - 

cagggaaucucuguuacugggg

 - 73

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; cloned [1]

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).