Stem-loop sequence dre-mir-461

AccessionMI0002183 (change log)
DescriptionDanio rerio miR-461 stem-loop
Stem-loop
   ---      -aaa   a  aa         ----   caauc 
5'    auuuug    auc gg  ugggcuaaa    ugc     a
      ||||||    ||| ||  |||||||||    |||     a
3'    uaaaac    ugg cc  accugguuu    acg     a
   gaa      auaa   a  ag         cuga   aaaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr16: 15562681-15562759 [+]
intergenic
Database links

Mature sequence dre-miR-461

Accession MIMAT0001889
Sequence

11 - 

ucaggaaugggcuaaaugccaa

 - 32

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).