miRBase entry: ssc-mir-122

Stem-loop ssc-mir-122


Accession
MI0002413
Description
Sus scrofa ssc-mir-122 precursor miRNA
Gene family
MIPF0000095; mir-122

Literature search
24 open access papers mention ssc-mir-122
(151 sentences)

Sequence

1 reads, 4 reads per million, 1 experiments
ccuuagcagagcugUGGAGUGUGACAAUGGUGUUUGUguccaaacuaucaAACGCCAUUAUCACACUAAAUagcuacuguuaggc
.((((((((((((((..(((((((.(((((((((((............))))))))))).)))))))..)))))).)))))))).

Structure
c        -      GG       C           Ugucc 
 cuuagcag agcugU  AGUGUGA AAUGGUGUUUG     a
 |||||||| ||||||  ||||||| |||||||||||      
 ggauuguc ucgaUA  UCACACU UUACCGCAAac     a
c        a      AA       A           uauca 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 179916336-179916420 [-]

Database links

Mature ssc-miR-122-5p

Accession MIMAT0002119
Description Sus scrofa ssc-miR-122-5p mature miRNA
Sequence 15 - UGGAGUGUGACAAUGGUGUUUGU - 37
Evidence experimental
454 [2], Illumina [3-5]

Mature ssc-miR-122-3p

Accession MIMAT0037315
Description Sus scrofa ssc-miR-122-3p mature miRNA
Sequence 51 - AACGCCAUUAUCACACUAAAU - 71
Evidence experimental
Illumina [6]

References

  1. PubMed ID: 15885146
    Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
    "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
    "BMC Genomics (2005) 6:70

  2. PubMed ID: 19196471
    Cloning, characterization and expression analysis of porcine microRNAs
    Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R
    BMC Genomics (2009) 10:65

  3. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  4. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  5. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100

  6. PubMed ID: 25230983
    The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing
    "Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M"
    "J Appl Genet (2015) 56:239-252