Stem-loop sequence ssc-mir-107

AccessionMI0002449 (change log)
DescriptionSus scrofa miR-107 stem-loop
Gene family MIPF0000024; mir-103
Literature search

11 open access papers mention ssc-mir-107
(33 sentences)

Stem-loop
   -      c      --c    u  u           c   u   a 
5'  uucucu ugcuuu   agcu cu uacaguguugc uug ggc u
    |||||| ||||||   |||| || ||||||||||| ||| ||| g
3'  gagaga acgaaa   ucgg ga auguuacgacg aac uug g
   c      c      cua    -  c           -   -   a 
Get sequence
Deep sequencing
17799 reads, 1.07e+04 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 110407095-110407181 [-]
sense
ENSSSCT00000011442 ; PANK1-201; intron 6
Database links

Mature sequence ssc-miR-107

Accession MIMAT0002155
Sequence

52 - 

agcagcauuguacagggcuauca

 - 74

Get sequence
Deep sequencing17786 reads, 15 experiments
Evidence experimental; cloned [2], 454 [3], Illumina [4-6]

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).
2
PMID:18548309 "Identification and characterization of new microRNAs from pig" Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS Mamm Genome. 19:570-580(2008).
3
PMID:19196471 "Cloning, characterization and expression analysis of porcine microRNAs" Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R BMC Genomics. 10:65(2009).
4
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
5
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
6
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).