Stem-loop sequence ppa-mir-98

AccessionMI0002701 (change log)
DescriptionPan paniscus miR-98 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gu                 u    ---------      aggg 
5'   gagguaguaaguuguau guug         uggggu    a
     ||||||||||||||||| ||||         ||||||    u
3'   uuucaucauucaacaua caau         accccg    a
   cc                 u    agaagauua      gauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (panpan1.1; GCA_000258655.2) Overlapping transcripts
chrX: 53878637-53878716 [-]
intergenic
Database links

Mature sequence ppa-miR-98

Accession MIMAT0002409
Sequence

2 - 

ugagguaguaaguuguauuguu

 - 23

Get sequence
Evidence by similarity; MI0000100

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).