Stem-loop sequence ptr-mir-30c-2

AccessionMI0002923 (change log)
Previous IDsptr-mir-30c
DescriptionPan troglodytes miR-30c-2 stem-loop
Gene family MIPF0000005; mir-30
Literature search

2 open access papers mention ptr-mir-30c-2
(2 sentences)

Stem-loop
      uacu       u   aca         guggaa 
5' aga    guaaaca ccu   cucucagcu      a
   |||    ||||||| |||   |||||||||       
3' ucu    cauuugu gga   gagggucga      g
      uucu       c   --a         aagaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr6: 74025074-74025145 [-]
intergenic
Database links

Mature sequence ptr-miR-30c

Accession MIMAT0002614
Sequence

7 - 

uguaaacauccuacacucucagc

 - 29

Get sequence
Evidence by similarity; MI0000736
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).