Stem-loop sequence mml-mir-181a-1

AccessionMI0002931 (change log)
Previous IDsmml-mir-213
DescriptionMacaca mulatta miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

3 open access papers mention mml-mir-181a-1
(41 sentences)

Stem-loop
   -u    -uu   -    -   uc  u a   u      cu       a    g  au 
5'   gagu   uga gguu gcu  ag g aca ucaacg  gucggug guuu ga  u
     ||||   ||| |||| |||  || | ||| ||||||  ||||||| |||| ||  a
3'   cuca   acu ccaa cgg  uc c ugu aguugc  cagcuac caaa cu  a
   ac    ucu   a    u   ua  c a   u      --       -    a  aa 
Get sequence
Deep sequencing
2608239 reads, 1.52e+04 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 167910267-167910376 [+]
antisense
ENSMMUT00000030466 ; NEK7-201; intron 5
Clustered miRNAs
< 10kb from mml-mir-181a-1
mml-mir-181a-1chr1: 167910267-167910376 [+]
mml-mir-181b-1chr1: 167910438-167910547 [+]
Database links

Mature sequence mml-miR-181a-5p

Accession MIMAT0002506
Previous IDsmml-miR-181a
Sequence

24 - 

aacauucaacgcugucggugagu

 - 46

Get sequence
Deep sequencing5130597 reads, 9 experiments
Evidence by similarity; MI0000289
Database links
Predicted targets

Mature sequence mml-miR-181a-3p

Accession MIMAT0002622
Previous IDsmml-miR-213;mml-miR-181a*
Sequence

64 - 

accaucgaccguugauuguacc

 - 85

Get sequence
Deep sequencing42936 reads, 9 experiments
Evidence by similarity; MI0000289
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).