Stem-loop sequence mml-mir-17

Accession MI0003001
Description Macaca mulatta miR-17 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    ga       -ca        a  g     g   -  au 
guca  auaaugu   aagugcuu ca ugcag uag ug  a
||||  |||||||   |||||||| || ||||| ||| ||  u
cagu  uauuacg   uucacgga gu acguc auc ac  g
    gg       aug        a  g     -   u  gu 
Get sequence
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [2]. The expression of this mature miRNA was validated by Miska et al [1].

Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1099214568803: 464-547 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-17
mml-mir-17 1099214568803: 464-547 [-]
mml-mir-18a 1099214568803: 331-401 [-]
mml-mir-19a 1099214568803: 180-261 [-]
mml-mir-20a 1099214568803: 17-87 [-]
Database links

Mature sequence mml-miR-17-5p

Accession MIMAT0002700
Sequence

14 - 

caaagugcuuacagugcagguagu

 - 37

Get sequence
Evidence experimental; cloned [1]
Predicted targets

Mature sequence mml-miR-17-3p

Accession MIMAT0002701
Sequence

51 - 

acugcagugaaggcacuugu

 - 70

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).