Stem-loop hsa-mir-518a-2

Accession

MI0003173

Symbol

HGNC: MIR518A2

Description

Homo sapiens hsa-mir-518a-2 precursor miRNA

Gene family

MIPF0000020; mir-515

Literature search

9 open access papers mention hsa-mir-518a-2
(13 sentences)

Sequence

45 reads, 8 reads per million, 14 experiments

ucucaagcuguggguCUGCAAAGGGAAGCCCUUUCuguugucuaaaagaagaGAAAGCGCUUCCCUUUGCUGGAuuacgguuugaga
(((((((((((((.(((((((((((((((.((((((.((.(.....).)).)))))).)))))))))))).))))))))))))))))

Structure

             g   -            C      g  g c 
ucucaagcugugg uCU GCAAAGGGAAGC CUUUCu uu u u
||||||||||||| ||| |||||||||||| |||||| || | a
agaguuuggcauu AGG CGUUUCCCUUCG GAAAGa aa a a
             -   U            C      g  g a 

Annotation confidence High

Comments

The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context

chr19: 53739333-53739419 [+]

Clustered miRNAs

7 other miRNAs are < 10 kb from hsa-mir-518a-2

Disease association

hsa-mir-518a-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-518a-5p

• Accession: MIMAT0005457
• Description: Homo sapiens hsa-miR-518a-5p mature miRNA
• Sequence: 16 - CUGCAAAGGGAAGCCCUUUC - 35
• Evidence: experimental ; array-cloned [1]

Mature hsa-miR-518a-3p

• Accession: MIMAT0002863
• Description: Homo sapiens hsa-miR-518a-3p mature miRNA
• Sequence: 53 - GAAAGCGCUUCCCUUUGCUGGA - 74
• Evidence: experimental ; array-cloned [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770