Stem-loop sequence tni-let-7h

AccessionMI0003208 (change log)
DescriptionTetraodon nigroviridis let-7h stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   aauuggcuuugcugu  u                 u      --------    au  ag 
5'                gg gagguaguaaguugugu guuguu        gggg  ca  a
                  || ||||||||||||||||| ||||||        ||||  ||   
3'                cc uuccgucauucaacaua caauag        uccc  gu  u
   --------------u  -                 u      aggaacug    ac  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
9: 3596422-3596520 [+]
sense
ENSTNIT00000018363 ; huwe1 (2 of 2)-201; intron 35
Clustered miRNAs
< 10kb from tni-let-7h
tni-let-7g9: 3596157-3596235 [+]
tni-let-7h9: 3596422-3596520 [+]
Database links

Mature sequence tni-let-7h

Accession MIMAT0002893
Sequence

18 - 

ugagguaguaaguuguguuguu

 - 39

Get sequence
Evidence by similarity; MI0001875