Stem-loop sequence fru-mir-19b

Accession MI0003237
Description Fugu rubripes miR-19b stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There maybe 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           -   -      uc    uuug 
gucaguuuugc ugg uuugca  cagc    u
||||||||||| ||| ||||||  ||||    u
cagucaaaacg acc aaacgu  gucg    a
           u   u      --    cgcc 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5) Overlapping transcripts
HE602547.1: 13071933-13071995 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-19b
fru-mir-17-1 HE602547.1: 13071306-13071391 [+]
fru-mir-18 HE602547.1: 13071440-13071515 [+]
fru-mir-19a HE602547.1: 13071578-13071658 [+]
fru-mir-19b HE602547.1: 13071933-13071995 [+]
fru-mir-92-2 HE602547.1: 13072087-13072149 [+]

Mature sequence fru-miR-19b

Accession MIMAT0002922
Sequence

40 - 

ugugcaaauccaugcaaaacuga

 - 62

Get sequence
Evidence by similarity; MI0001904