Stem-loop sequence fru-mir-19b

AccessionMI0003237 (change log)
DescriptionFugu rubripes miR-19b stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
              -   -      uc    uuug 
5' gucaguuuugc ugg uuugca  cagc    u
   ||||||||||| ||| ||||||  ||||    u
3' cagucaaaacg acc aaacgu  gucg    a
              u   u      --    cgcc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602547.1: 13071933-13071995 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-19b
fru-mir-17-1HE602547.1: 13071306-13071391 [+]
fru-mir-18HE602547.1: 13071440-13071515 [+]
fru-mir-19aHE602547.1: 13071578-13071658 [+]
fru-mir-19bHE602547.1: 13071933-13071995 [+]
fru-mir-92-2HE602547.1: 13072087-13072149 [+]
Database links

Mature sequence fru-miR-19b

Accession MIMAT0002922
Sequence

40 - 

ugugcaaauccaugcaaaacuga

 - 62

Get sequence
Evidence by similarity; MI0001904