Stem-loop sequence fru-let-7a-3

AccessionMI0003244 (change log)
DescriptionFugu rubripes let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ------------     u          gu         ---ugg        a 
5'             caggg gagguaguag  uguauaguu      uggguggg u
               ||||| ||||||||||  |||||||||      ||||||||  
3'             guucc uuccguuauc  acauaucaa      acccgccc u
   gucacucgagga     -          ug         uagugg        g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602537.1: 8251172-8251265 [-]
intergenic
Clustered miRNAs
< 10kb from fru-let-7a-3
fru-let-7eHE602537.1: 8251435-8251534 [-]
fru-let-7a-3HE602537.1: 8251172-8251265 [-]
Database links

Mature sequence fru-let-7a

Accession MIMAT0002928
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001857