Stem-loop sequence tni-let-7i

AccessionMI0003296 (change log)
DescriptionTetraodon nigroviridis let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   c    u                 u   --------   u    u u 
5'  uggc gagguaguaguuugugc guu        ggu gggu g g
    |||| ||||||||||||||||| |||        ||| |||| | a
3'  aucg uuccgucaucgaacgcg cag        ucg cccg c c
   -    -                 u   uagaggua   -    u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
13: 9044989-9045072 [-]
intergenic
Database links

Mature sequence tni-let-7i

Accession MIMAT0002978
Sequence

6 - 

ugagguaguaguuugugcuguu

 - 27

Get sequence
Evidence by similarity; MI0001876