Stem-loop sequence fru-let-7j

AccessionMI0003341 (change log)
DescriptionFugu rubripes let-7j stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   gucu         u           ugagggucugugauu 
5'     gagguaguu uuuguacaguu               c
       ||||||||| |||||||||||               u
3'     uuccgucag gaacaugucaa               g
   -ccg         u           ucgaggacauacccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602553.1: 6795841-6795922 [-]
intergenic
Database links

Mature sequence fru-let-7j

Accession MIMAT0003013
Sequence

4 - 

ugagguaguuuuuuguacaguu

 - 25

Get sequence
Evidence by similarity; MI0001874