Stem-loop sequence osa-MIR535

AccessionMI0003505 (change log)
DescriptionOryza sativa miR535 stem-loop
Gene family MIPF0000136; MIR535
Literature search

20 open access papers mention osa-MIR535
(32 sentences)

Stem-loop
                a            c      -----    u a   u 
5' ggcggugacaacg gagagagcacgc ggugcg     gcgg c cgg g
   ||||||||||||| |||||||||||| ||||||     |||| | |||  
3' ccgucacuguugc cucuuucgugcg ccaugc     cgcc g gcc a
                c            u      ggcgg    c -   g 
Get sequence
Deep sequencing
5845 reads, 3.7e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 16290530-16290623 [-]
intergenic
Database links

Mature sequence osa-miR535-5p

Accession MIMAT0003142
Previous IDsosa-miR535
Sequence

6 - 

ugacaacgagagagagcacgc

 - 26

Get sequence
Deep sequencing5823 reads, 2 experiments
Evidence experimental; cloned [1]
Database links

Mature sequence osa-miR535-3p

Accession MIMAT0022927
Sequence

71 - 

gugcuuucucccguugucacu

 - 91

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).