miRBase entry: mmu-mir-487b

Stem-loop mmu-mir-487b


Accession
MI0003534
Symbol
MGI: Mir487b
Description
Mus musculus mmu-mir-487b precursor miRNA
Gene family
MIPF0000018; mir-154

Literature search
17 open access papers mention mmu-mir-487b
(59 sentences)

Sequence

17851 reads, 285 reads per million, 72 experiments
ugguacuuggagagUGGUUAUCCCUGUCCUCUUCGcuucacucaugccgAAUCGUACAGGGUCAUCCACUUuuucaguauca
(((((((.(((((((((....((((((.(..(((((.........).))))..).))))))....))))))))).)))))))

Structure
       u         UUAU      C UC    - uuc 
ugguacu ggagagUGG    CCCUGU C  UUCG c   a
||||||| |||||||||    |||||| |  |||| |   c
acuauga uuuUUCACC    GGGACA G  AAgc g   u
       c         UACU      U CU    c uac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr12: 109727333-109727414 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from mmu-mir-487b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-487b-5p

Accession MIMAT0017216
Description Mus musculus mmu-miR-487b-5p mature miRNA
Sequence 15 - UGGUUAUCCCUGUCCUCUUCG - 35
Evidence experimental
Illumina [4]
Database links
Predicted targets

Mature mmu-miR-487b-3p

Accession MIMAT0003184
Description Mus musculus mmu-miR-487b-3p mature miRNA
Sequence 50 - AAUCGUACAGGGUCAUCCACUU - 71
Evidence experimental
cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267