Stem-loop sequence bta-mir-20b

Accession MI0005015
Description Bos taurus miR-20b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     -ca           g     g   uuuu     
aguac   aagugcucaca ugcag uag    ggca 
|||||   ||||||||||| ||||| |||    ||| g
ucaug   uucacgggugu auguc auc    ucgc 
     acc           g     -   ----     
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chrX: 17918133-17918201 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-20b
bta-mir-106a chrX: 17918527-17918607 [-]
bta-mir-18b chrX: 17918368-17918442 [-]
bta-mir-20b chrX: 17918133-17918201 [-]
bta-mir-19b-2 chrX: 17918008-17918090 [-]
bta-mir-92a-2 chrX: 17917857-17917924 [-]
bta-mir-363 chrX: 17917702-17917775 [-]
Database links

Mature sequence bta-miR-20b

Accession MIMAT0003796
Sequence

6 - 

caaagugcucacagugcaggua

 - 27

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).