Stem-loop sequence sme-mir-2b

AccessionMI0005133 (change log)
DescriptionSchmidtea mediterranea miR-2b stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
          -gc        uu         cagu     u 
5' gguuauu   uuucauca  guugguugu    uauug a
   |||||||   ||||||||  |||||||||    |||||  
3' ucgauag   agaguagu  uaaccgaca    auaac u
          agu        uu         --cu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig242: 185781-185857 [-]
intergenic
Database links

Mature sequence sme-miR-2b-5p

Accession MIMAT0003965
Previous IDssme-miR-2b*
Sequence

12 - 

ucaucauuguugguugucag

 - 31

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-2b-3p

Accession MIMAT0003966
Previous IDssme-miR-2b
Sequence

47 - 

ucacagccaauuuugaugagau

 - 68

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).