Stem-loop sequence sme-mir-87b

AccessionMI0005155 (change log)
DescriptionSchmidtea mediterranea miR-87b stem-loop
Stem-loop
   uuc     -- g   u  ugc      c   a         aau     uu  u   a 
5'    auuga  u cgu ga   uucauu gaa uuuugcuca   ccauu  ga aau a
      |||||  | ||| ||   |||||| ||| |||||||||   |||||  || |||  
3'    uggcu  a gca cu   gaguaa cuu gaaacgagu   gguag  cu uua u
   --c     ua g   -  uua      a   c         ---     --  u   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig17117: 10830-10937 [-]
intergenic
Database links

Mature sequence sme-miR-87b-5p

Accession MIMAT0012110
Sequence

21 - 

ucauucgaaauuuugcucaaaucc

 - 44

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-87b-3p

Accession MIMAT0003990
Previous IDssme-miR-87b
Sequence

70 - 

gugagcaaagcuucaaaugag

 - 90

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).