Stem-loop sequence sme-mir-756

AccessionMI0005182 (change log)
DescriptionSchmidtea mediterranea miR-756 stem-loop
Stem-loop
   uaaaa  ug     aauc    u       uu       ---c    uu 
5'      gu  ggaua    gaua gugguaa  uggauga    auaa  a
        ||  |||||    |||| |||||||  |||||||    ||||   
3'      ca  cuuau    cuau uacuauu  accuacu    uguu  a
   --gua  gu     aaaa    u       cu       cuaa    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig217: 54473-54567 [-]
intergenic
Database links

Mature sequence sme-miR-756-5p

Accession MIMAT0004023
Previous IDssme-miR-756
Sequence

18 - 

cgauaugugguaauuuggauga

 - 39

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-756-3p

Accession MIMAT0012127
Previous IDssme-miR-756*
Sequence

60 - 

cauccaucuuaucauuuaucaa

 - 81

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).