Stem-loop sequence mdo-let-7a-2

AccessionMI0005330 (change log)
DescriptionMonodelphis domestica let-7a-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   -   uu   g   u             uagaa ua a 
5'  agg  gag uag agguuguauaguu     u  c u
    |||  ||| ||| |||||||||||||     |  | c
3'  ucc  uuc auc uccgacaugucaa     a  g a
   u   -u   g   c             --uag gg a 
Get sequence
Deep sequencing
7686365 reads, 1.26e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 226185493-226185565 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7a-2
mdo-mir-100chr4: 226180101-226180180 [+]
mdo-let-7a-2chr4: 226185493-226185565 [+]
Database links

Mature sequence mdo-let-7a-5p

Accession MIMAT0004141
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing23084043 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

Mature sequence mdo-let-7a-3p

Accession MIMAT0026686
Sequence

50 - 

cuguacagccuccuagcuuucc

 - 71

Get sequence
Deep sequencing110 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).