Stem-loop sequence mdo-let-7f-2

AccessionMI0005349 (change log)
DescriptionMonodelphis domestica let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ---    u   gu               ----  ua     ac 
5'    ggga gag  aguagauuguauagu    uu  ggguc  a
      |||| |||  |||||||||||||||    ||  |||||   
3'    cccu uuc  ucaucugacauauca    ag  ucuag  c
   gca    -   ug               auag  gc     cc 
Get sequence
Deep sequencing
5614552 reads, 9.04e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001583589.1: 35394-35473 [-]
intergenic
Database links

Mature sequence mdo-let-7f-5p

Accession MIMAT0004161
Sequence

5 - 

ugagguaguagauuguauaguu

 - 26

Get sequence
Deep sequencing11175383 reads, 5 experiments
Evidence experimental; PCR [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-let-7f-2-3p

Accession MIMAT0031040
Sequence

55 - 

cuauacagucuacugucuuucc

 - 76

Get sequence
Deep sequencing1035 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).