Stem-loop sequence mdo-let-7a-3

AccessionMI0005350 (change log)
DescriptionMonodelphis domestica let-7a-3 stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   g   u   gu     gu         ugggggucgcucc 
5'  ggg gag  aguag  uguauaguu             c
    ||| |||  |||||  |||||||||              
3'  ccc uuc  ucauc  acauaucaa             u
   -   u   ug     ug         uagagugucuguc 
Get sequence
Deep sequencing
7676482 reads, 1.26e+05 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 11049697-11049775 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-let-7a-3
mdo-let-7a-3chr8: 11049697-11049775 [-]
mdo-let-7bchr8: 11048200-11048287 [-]
Database links

Mature sequence mdo-let-7a-5p

Accession MIMAT0004141
Sequence

5 - 

ugagguaguagguuguauaguu

 - 26

Get sequence
Deep sequencing23084043 reads, 5 experiments
Evidence experimental; Microarray [1], PCR [1]
Database links
Predicted targets

References

1